(Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. Artefactual values below 0% values were not depicted. The Etruscans: a population-genetic study. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. Haplogroup G-M285 - Wikipedia The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. Genetic evidence concerning the origins of South and North Ossetians. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. Its estimated Td of 120953000 years ago suggests considerable antiquity allowing time to accumulate STR diversity and also to disperse relatively widely. PubMed All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. Flores C, Maca-Meyer N, Gonzalez AM et al. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. G1-M285, previously described in the Iranian population . Iceman tzi, known to have been a haplogr. However, its sub-clades have more localized distribution with the U1-defined branch largely restricted to Near/Middle Eastern and the Caucasus, whereas L497 lineages essentially occur in Europe where they likely originated. Article The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. Ann Hum Genet 2008; 72: 205214. Am J Hum Genet 2004; 74: 788788. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. Am J Hum Genet 2008; 82: 236250. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. (2000) suggested 17,000 years ago. (a) Principal component analysis by population. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. Battaglia V, Fornarino S, Al-Zahery N et al. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. Internet Explorer). Am J Hum Genet 2002; 70: 265268. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Am J Hum Genet 2012; 90: 573. In the Greek island of Crete, approximately 7%[18] to 11%[19] of males belong to haplogroup G. Google Scholar. Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. Another notable feature is its uneven distribution. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. The L141 mutation is found on the Y chromosome at 2948607. We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. Article Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. Haplogroup G represents one of the first peoples in Europe. MH and MHS are thankful to the National Institute for Genetic Engineering and Biotechnology, Tehran, Iran, and the National Research Institute for Science policy, Tehran, Iran, for providing the samples. A subset of 693 samples was typed for short tandem repeats of Y-chromosome (Y-STRs) using the 17 STR markers in the Applied Biosystems AmpFlSTR Yfiler Kit according to manufacturer recommendations. ), Haplogroup M, as of 2017, is also known as K2b1b. Haplogroup P (P295) is also klnown as K2b2. Behar DM, Yunusbayev B, Metspalu M et al. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. Luis JR, Rowold DJ, Regueiro M et al. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Excavating Y-chromosome haplotype strata in Anatolia. The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). [41] These classifications are based on shared SNP mutations. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Distribution. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. Google Scholar. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. Genomics 1999; 57: 433437. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . Y chromosomal heritage of Croatian population and its island isolates. Achilli A, Olivieri A, Pala M et al. You are using a browser version with limited support for CSS. No labs have yet assigned them shorthand names. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Proc Natl Acad Sci USA 2011; 108: 97889791. Vernesi C, Caramelli D, Dupanloup I et al. King RJ, Ozcan SS, Carter T et al. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. The British samples have inconsistent double values for STR marker DYS19 in many cases. Eur J Hum Genet 2010; 18: 348353. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. ISSN 1476-5438 (online) In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Lacan M, Keyser C, Ricaut FX et al. Because M201 was identified first, it is the standard SNP test used when testing for G persons. CAS G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. To obtain The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. [7], (Subclades here conform to the Y-DNA SNP definitions used by ISOGG In 2012, several categories found only in one man in research studies were removed from the ISOGG tree causing some renaming. BMC Evol Biol 2011; 11: 69. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. Am J Hum Genet 2007; 80: 759768. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. Interestingly, the decrease of hg G frequency towards the eastern European populations inhabiting the area adjacent to NW Caucasus, such as southern Russians and Ukrainians,18, 40 is very rapid and the borderline very sharp, indicating that gene flow from the Caucasus in the northern direction has been negligible. Haak W, Balanovsky O, Sanchez JJ et al. Almost all L141 men belong to L141 subclades. Ancient DNA suggests the leading role played by men in the Neolithic dissemination. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. In the case of the general frequency pattern of hg G, panel (a) was obtained by applying the frequencies from Supplementary Table S1 together with data taken from the literature, concerning 569 individuals representing 7 populations comprising Algerians,47 Oromo and Amhara Ethiopians,48 and Berbers, Arabs and Saharawis from Morocco.49 Dots on the map (a) indicate the approximate locations of the sampled populations. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). G2a2b1 is more common in southern Europe than northern Europe. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. Am J Hum Genet 2001; 68: 10191029. Russ J Genet 2004; 40: 326331. PubMedGoogle Scholar. In the meantime, to ensure continued support, we are displaying the site without styles In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Origin. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. An assessment of the Y-chromosome phylogeography-based proposal that the spread of G2a-L497 chromosomes originated from Central Europe could be achieved by typing this SNP in the Holocene period human remains from Germany31 as well as those from France and Spain.45, 46 Certainly, Y chromosome represents only a small part of human genome and any population-level interpretation of gene flow in this region would have to be supported by genome-wide evidence. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. We attempted to localize the potential geographic origin of . Cinnioglu C, King R, Kivisild T et al. Hum Genet 2009; 126: 707717. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Origin. Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. Men with the haplogroup G marker moved into Europe in Neolithic times. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. Ann Hum Genet 2004; 68: 588599. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. Network of 248 samples P303 derived from Supplementary Table S3. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). . [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. Balanovsky O, Dibirova K, Dybo A et al. Haplogroup Definition & Meaning | Dictionary.com The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. and JavaScript. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. This is likely due to a local founder effect.[40]. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. The SNP L177 (a.k.a. A network of 61 G2c-M377 lineages from Europe, the Near/Middle East and Central and South Asia reveals founder lineages (one pronounced founder in Ashkenazi Jews and a far distant one among South Asian individuals) and diverged lineages (Supplementary Figure S1). The expansion time of G-M406 in Anatolia is 12800 years ago, which corresponds to climatic improvement at the beginning of the Holocene and the commencement of sedentary hunter-forager settlements at locations, such as Gobekli Tepi in Southeast Anatolia, thought to be critical for the domestication of crops (wheat and barley) that propelled the development of the Neolithic. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians).

Happiness Is To Mood As Rain Is To Answer, Articles H